Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:340-g11   

Cenix:340-g11RNAiCenix:340-g11
PCR_productcenix:340-g11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC54C6.2 Source_evidenceePCR267WS150 Sequence/Annotation Release
Overlaps_Gene C54C6.2 Source_evidenceePCR267WS150 Sequence/Annotation Release
Chunk_score Abs_score246
Max_abs_score246C54C6.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII35392673539560
Overlaps_transcriptC54C6.2 Source_evidenceePCR267WS150 Sequence/Annotation Release
WB_DNA_textTH:340-g11294aacttttccgcgtctccataatagtacctgtaaattgttcagagattctcttgaacaactcctgaatagctgtcgagtttccaataaaagtggccgacatcttgagcccacgtggtggaatatcacagaccgcagtcttcacattattcggaatccattcaacaaaatacgaagagttcttattctgcacattcatcatttgatcatcgacttctctcattgacatacgtccacggaacattgcagctacagtcaggtaacgtccgtgtctcggatcacaggcagccatcatat