Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:340-h4   

Cenix:340-h4RNAiCenix:340-h4
PCR_productcenix:340-h4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene T20B12.2 Source_evidenceePCR705WS150 Sequence/Annotation Release
Chunk_score Abs_score663
Max_abs_score663T20B12.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII73848107385566
Overlaps_transcript T20B12.2.1 Source_evidenceePCR705WS150 Sequence/Annotation Release
T20B12.2.2 Source_evidenceePCR705WS150 Sequence/Annotation Release
WB_DNA_textTH:340-h4757gcaaatgcattcacatctcgccaactccaatctcaacttgaacataaatccagcttcagtcggacctgatcgtaatcctggatcagttatgcatcacaatttggacatcaatcctccatcagttgcatatcagaatttgacagttccaatgacaccacttgcatattctgtatatgatcgagatgctctgacacatcaggctccggcaagtaacatcgctgccacaatggttccagcaactccagcaagtcaattggatattccgatgccagctcttcagaacattgtctctacagtcaatttgggagttcaattggatttgaagaagattgcattgcacgcgagaaacgccgaatacaatccaaaacgtttcgcagcagtcattatgagaattcgtgaaccaagaacaactgctttaattttttcgagtggaaaaatggtgtgcactggtgcgaagtcagaagaagcaagtcgattggcagcacgaaaatatgcgagaattgttcaaaagttgggatttcaggcgaaatttaccgaatttatggtaagtgtttctggaaaaaggtcacaaaatcatttgaataatttttttgtaggttcaaaacatggttggttcttgtgatgttcgttttccgattcaacttgaaggattgtgcattactcactctcagttcagtacttacgaaccagaattgttccctggattaatttatcgtatggtcaaaccaagagttgtgctccttatttttgtgtctgg