Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:341-a6   

Cenix:341-a6RNAiCenix:341-a6
PCR_productcenix:341-a6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F37C12.4 Source_evidenceePCR301WS150 Sequence/Annotation Release
Chunk_score Abs_score259
Max_abs_score259F37C12.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII71801797180529
Overlaps_transcript (3)
WB_DNA_textTH:341-a6351agcggaccaggaattgaaggtttggccgtcggtctcaacaagggacatgctgctacccaacttccagttaagcagcgtcaaaacagacacaagggagtcgcctccaagaagaccaaggtttgttattatccaatttttcggattaaaatatttattaaagtttttagatcgtccgagagctcgttcgtgagatcaccggattcgctccatacgagcgtcgcgttctggaaatgcttcgtatctccaaggacaagcgcgccctcaagttcttgaagagacgcatcggaacccaccgtcgtgctaagggaaagagagaggaactccaaaacgtcatcatcgctcaacgcaaag