Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:341-d5   

Cenix:341-d5RNAiCenix:341-d5
PCR_productcenix:341-d5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene K01G5.4 Source_evidenceePCR391WS150 Sequence/Annotation Release
Chunk_score Abs_score328
Max_abs_score328K01G5.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII1074677410747258
Overlaps_transcript K01G5.4.1 Source_evidenceePCR391WS150 Sequence/Annotation Release
K01G5.4.2 Source_evidenceePCR391WS150 Sequence/Annotation Release
K01G5.4.3 Source_evidenceePCR391WS150 Sequence/Annotation Release
WB_DNA_textTH:341-d5485tcatcgtcgtcatctggaagatcagccttggcggcgttgtccagatccttttcgtattcggcaatcatggctgggtccatttgaacctggaaattaaaatattgcttatgaaagaacatggatttaaaaatacctctggaggagccaaagctggcattgcgacaaactcgaggtttggatctccgagcagctttctggcgagccagaggaatggcttttcgaagttatagttcgactttgcggagatgtcgtagtattggaggttcttctttcggtggaaggtgatggtcttggccttcactttacggtccttgacgtcgacctgaaatttgtaattgaatatattggccagtttcagctagtgattaccttatttccgcagagaacaattggaatgttttcacatactctggccaaatcgcgatgccagttcgggacattcttgtaggtgacacgagcggtaacatcgaacatgataatggcgc