Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:341-e8   

Cenix:341-e8RNAiCenix:341-e8
PCR_productcenix:341-e8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS ZK520.4a Source_evidenceePCR977WS150 Sequence/Annotation Release
ZK520.4c Source_evidenceePCR977WS150 Sequence/Annotation Release
ZK520.4d Source_evidenceePCR878WS150 Sequence/Annotation Release
Overlaps_Gene ZK520.4 Source_evidenceePCR977WS150 Sequence/Annotation Release
Chunk_score Abs_score956
Max_abs_score956ZK520.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII1368937213690348
Overlaps_transcript (5)
WB_DNA_textTH:341-e8977tgccagaaagttatgataaaagctcacaaggataaacttcacgcagtgtgccatgatctcattactaatgaggagaacaaggacctccgcaacatgtacagactgttgaagcccattcaagcgggactctcggtaatggttaaggagttcgaggaatatgtgaagaagaaggggctcgaggcggtgtcgaggctcaccggcgagaatgtaccccagcaatttgtggagaatgtgttacgggtgtataacaagttcaatgatatgaagactgctgtgttcatggacgatggcgagttctctagtggactcgacaaggcgttgcagggagtcgtgaactcgaaggagccaggacagtcggtgccgaaggccagtgagcggttggcgagatatacggatgggttgctcaaaaagtccacgaaaggactatcggagacggatttggaggcgaaactcgacagtgcaattgtgattttccgctatatagaggataaggatatattccagaagttctactcgaaaatgctcgcaaatcggcttatagcaagcacatcgatatcgatggacgccgaggagctgatgattaacaagttgaaacaggcgtgtggttatgaattcaccagtaaactgtcacgaatgttcaccgatatcgggcttagccaggagctatcgaacaactttgataagcacattgcggacattaaaactgtgcagcccgacgtgaagtttgtgccgacacagacgatgattctgcaggcaggtagctggccgctcaacgctccacagctctctacgaattcgaataatcagaccgcacaagacgtggccaacttccatctgccacgtatcctgcagcctgtgattcaggagtttgagaagttctacactgggaagcacaacgggcgaaaactgacatggcttttcaatatgtcacagggagatgtcaggcttacatacctcgataagcagtatgtcgcaca