Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:341-h1   

Cenix:341-h1RNAiCenix:341-h1
PCR_productcenix:341-h1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene ZK512.5 Source_evidenceePCR969WS150 Sequence/Annotation Release
Chunk_score Abs_score885
Max_abs_score885ZK512.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII91272459128352
Overlaps_transcript ZK512.5.2 Source_evidenceePCR969WS150 Sequence/Annotation Release
ZK512.5.1 Source_evidenceePCR969WS150 Sequence/Annotation Release
WB_DNA_textTH:341-h11108caagcggatgcaagaagaattctccctgaagcaactggaagccgacagattggcgtacgaaaaagcacgacaagaagctgcagagagcgagaaactggatttcaatcagtgagtatggaaccaacggtacaatgagcaaaaatattattataggcataaaatcgaggaacgcgaagagccaaaacttaacatctcgcaacccgaagaagtgttgagcaacggaccacttcattatcactcctgccttcagtttgctaccattggtgttggaggaaaattggtgatcattaaaccagcgggaaccatcgatagtatcactggacatgttctaagtacatccagcgttcatgtggatgatctgaaaacatttcttcatttcgatgaacaatctggaaaagtgatcgaatcagttcagaactttaaaggaccactgattgctggacaaactccaactcattccgttcgtctctacatccaacgacaaatcgacgctcttcgccagatcagaaatgctggtgacgtaaagaaaagtgaggtggtggatgctcttctcgtctggcaattgctcgaaatcatggttcagcaacatggagtaagaattgttttaatttgagaacttagtaggaatttaacattttaagagagtcaccggacccgatgtagcaacactgctgacaaatgcctcggaagaacttggtgaaaaaactggaatttcaagcaatgggacatccgagtctggttcgaagttcgaagcaaaggagcggttcaataagtatcttcttggtggtcacattaatgtaattttgtctaatcttgttaattaaataattataatttttcaggaagctgttgaaagtgctataaccgatggactctatgccgacgcaatgacattgatccgtagactgcatccaaatgacgctaagaaaattgaggaaatcgaggcacgatttatgaatcttcgttccattgacgatccattcgcaacactggttgcagtttcaagtgatcaaccacctccgattctgacgaattcggcgttcgatgatgacaacaattggaaacgacatgcggccattgttcttgcgaatctaaactcgcagaccgc