Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:36-c2   

Cenix:36-c2RNAiCenix:36-c2
PCR_productcenix:36-c2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C47E12.5 Source_evidenceePCR533WS150 Sequence/Annotation Release
Chunk_score Abs_score512
Max_abs_score512C47E12.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV99908109991342
Overlaps_transcript (8)
WB_DNA_textTH:36-c2533ttgacaccggatttaggctcgaaaggttccggattcaccgaaagagcgacacgaataacttcttctctgtccaaaattggttgaactccgtataactcggcaatgagaattgacgcagcaaaaacgaaattgaagtgttcttctttggatggatcaaaattgagaacatgcgggcaacgcttagctcctgaccagaacttggctccagaatcagtgagttgatctggtgggaaagagtgaagcatctgagcaatattgttgtggtagagttcctggaattggttgcgagcccaacgaatacaatcttcagcagacgatggacgagcatcaatcaaagcgtcttttactttttgaagaatatcaatttgttgtccagaaattaatttgtcgacatgctcattgaaccctctttcatcggaaaggaacttgttggccatttctcctggctgggcgaagaatgtttcaaattgctcacgcgcccattgaattgtgtgctgaatttcattggggaagttcttcaacgtgcaaacagg