Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:42-c8   

Cenix:42-c8RNAiCenix:42-c8
PCR_productcenix:42-c8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSW03F8.10 Source_evidenceePCR543WS150 Sequence/Annotation Release
Overlaps_Gene W03F8.10 Source_evidenceePCR543WS150 Sequence/Annotation Release
Chunk_score Abs_score501
Max_abs_score501W03F8.10
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV51812815181961
Overlaps_transcriptW03F8.10 Source_evidenceePCR543WS150 Sequence/Annotation Release
WB_DNA_textTH:42-c8681caaaggcaaaggctgaaaaggcttatgaagttgcaaagaatactgcacaaagagcaaatagctcgagagctgaacttgataaaattgctgaagagatcggagagttcttgactgcccagaagagttcaccagaacaaatccgcaatttggcagaggaagttcttggcaaggaaatcagtttgacgccagatcagattactgacttgacaggaaagatcaaggaatcactggcaaagatcaataacatcgatgagattctgaatgagacaagaggaaacaagagtattgcagctaatctggaatcgagagtgagtaaactgagtttagaattatttactgtttcaacaaattgaaaaaagaaaaaaaaagaaaaaattttattaggaacagtgatgtttgtacttcttcttgtttttgctttcaacattctaaaacaataattttaggccgtaaaagcgaacaaagaagctgaactccttcaaaaggcaatggaagagattcgcgaggcacttcaactggcagatcaagcctacaacaacgtaacttccgtacttgaggagatcgacacaatgcaagtacaagcccgtgagctcatcgacaaggctcgtaactctacagaagccgtcgaggggaaggcacaagctgccaacacgacacttgccgagttggaaggtgtgatga