Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:46-d8   

Cenix:46-d8RNAiCenix:46-d8
PCR_productcenix:46-d8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS C55A6.11 Source_evidenceePCR224WS150 Sequence/Annotation Release
C55A6.9 Source_evidenceePCR993WS150 Sequence/Annotation Release
Overlaps_Gene C55A6.11 Source_evidenceePCR224WS150 Sequence/Annotation Release
Chunk_score Abs_score182
Specificity_index0.158
Rel_score0.187
Map_statusBottom50_percentile_ePCRV1152385611525554
C55A6.9 Source_evidenceePCR1077WS150 Sequence/Annotation Release
Chunk_score Abs_score972
Max_abs_score972C55A6.9
Specificity_index0.842
Rel_score1
Map_statusBest_ePCRV1152385611525554
Overlaps_transcript C55A6.9 Source_evidenceePCR1077WS150 Sequence/Annotation Release
C55A6.11 Source_evidenceePCR224WS150 Sequence/Annotation Release
WB_DNA_textTH:46-d81699gatcttggctgtgggatgttttctttggaagtagtgaagagctaaatgctgaaatggagaatactgttagctttgttcagcgtgaaagtatcggaatgcacgatgatcatgataatgtaggctttaaaagttcacaaccccacatttatataattttccagaaaggagcattggctctctacattgctggaccattcattgtcacctttatatttacattattgtcccttttacaatattatcatgttaatgatggcattttgtcataaaataaatattatcgtgacgagaacgctggaaattcacaaaacaaaaaatactttttgaacacccgcgcaaaactggttatgcgccattgttccctgctgacgcgcattgagcgcttgcgcaaaacccgtgtgtgagagtttgaatttaattccctcggtgactagttttttcgatttgcagccgtttctgccgattggtatcttaatattataactaaattactataaaaaatgccccaagaatcctcagatgccaaaaggattgaacctccgtaagtattattgttttgaatcgctagaaaagttttgaaaacattttgcagacgaaaagtggatttcatgctgaaacctcgatttaccaatactgttcctgatgtcccatttgatgcaaagtttatgacttgtccatttgttcctctgggaaggtacaccaattttgaaacgtttgacattgttcaatatctctgaatttagatttgtcgaattccaacctgctgccatttatcgagattacaagcatgcagtcatttgtgacgacgacatgggtttgaatgtcgatttgattgatctaaaaaaatacgacgaagatccaatcgaaactgtaggttttttcctgaaatatacagtttcaaagatagaaatgtttcacttttaggaaattgatgagaaagacaatattttactggaagatgatggcgccgctaaattgattgcaaaacgatctcaacagcattctaaacttgttccatggatgagaaaaaccgagtacatttcaactgaattcaatcggttcggtgtgacagccgatagacaggagacgaagcttggttataacttgaagaaaaatcaacaagttgaagatatgtatcgtgacaagcagagtcaaattgatgccattaacaagacatttgaagatgtaagtaccagaatatatttttttgatttaaatctacttttgcgtattttaggttcgtaaacccgtcaaggagcattactccaagaagggtgtaaaagctgttgaagaaagctttgtcttccctgatttcgatcactggaaacacctctttgctcatgtacaatttgatggagacactataacaacagaattcgaagaagaagatgaacgacaacaagcacgggagagcagtgttattaaagccatggaattcgaagatcaaaaatttgcagcagtttttgttccaacgattggatgtcttacgagttttatggatgatcttgagttagaacgaccatttgatgaggatatgaagtacgaattcttgctaagccgtgaatacacatttaaaatggaacacttgccaccaagggatcgtgacgtcttcattatgtatcatcgtaataacgttttccagtacaacgaagttgactgtaatgtcaagatgacaagaaaaccaaaaatggcattgagc