Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:50-b2   

Cenix:50-b2RNAiCenix:50-b2
PCR_productcenix:50-b2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST11F9.12 Source_evidenceePCR511WS150 Sequence/Annotation Release
Overlaps_Gene T11F9.12 Source_evidenceePCR511WS150 Sequence/Annotation Release
Chunk_score Abs_score468
Max_abs_score468T11F9.12
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1149805611498718
Overlaps_transcriptT11F9.12 Source_evidenceePCR511WS150 Sequence/Annotation Release
WB_DNA_textTH:50-b2663cggtatggcggaaacagttatcctatcataaatagagttggaagatgaagaactgattggtgaataggaagatggctgatatcttgcagttgtcacacgaactcttgttgcgggttcggtggtagtaggtgcaactgttgttgtagtagttgtcgaagtagttgtagaaggtgtagtagttgtatgatggtgatggtggtggtgttgatggtggattctatcttgtccatatcgatgacggtttggatcatggacagatgggtatctatataaaacaaaaatacaattcacatgtatttattttcatttacaaacctagtggtatatgtccatgttcgaattcgcgttgtggttggagatgcagtggtgctagttgaggaactttcagtcattgtagttgtgctcggaattgtagtagttgttgtagtttgaggttgagttgtagataaagtggtagacgctgaagttgttctcaacgtagttgtagtttgctctcttgttgtagttataggaactggcgtctttctcggcggagctgttatccactctacttcttcggatttttctatctcctcaattttgttgttttcttccgatgatcttcctacgtttaccacaactggtgcttcagtgtagacaaaatcggagggtaactccaagtca