Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:50-c2   

Cenix:50-c2RNAiCenix:50-c2
PCR_productcenix:50-c2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene W03C9.7 Source_evidenceePCR507WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRII1196982511970601
Y75B8A.8 Chunk_score (3)
Overlaps_transcript W03C9.7.1 Source_evidenceePCR507WS150 Sequence/Annotation Release
W03C9.7.2 Source_evidenceePCR507WS150 Sequence/Annotation Release
WB_DNA_textTH:50-c2777cgtcatttccagtcggatttttctgatttttcgttaaaaatcttcaaattcctattcattttatagaaatagagctgccaaacccattgattttttagtgaaatttttcaaatgttctgttttctcgctattttttaattgaaaaaatcaaaatttgagtcattttcagcgcagatttcctaatttttcccgaaaaatattcaaaatctagtagatttccataggaatttttaatttttaattaaaaaaaaattcttgcagggtcttccactgagcgagtacaaccgtgctcttcaagaaggcgagatctcaccggctcgcgacgacgagatcaccaatcccgacgaatcatcatcccaagtggaggatctgagtgagcttcaccatcgacaacatcagcagcagcagcagtaccaacaacgctatcgtcggccaccattcaacaatttccacgatatgtcggatagtggatacagtgctcctcgccgccggcttcatcatcaattcgagcatcttggtagtgagcagcagcagcagcagcagcagcagacaccagctccgaagattgtctatccatcgatgcaagttgtcaatattgaaatggcaactggtgacggacctaaaaggtctgacaatcatcattatcatcatcatcatcatcaacgtcgtcatattccggcaccaccatccaccggtccactgagctctctcattgatcaggccgactatgaagcttctatggcaagcgggaaaatgttcggaaaaccagttagtccg