Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:50-d8   

Cenix:50-d8RNAiCenix:50-d8
PCR_productcenix:50-d8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY37H2C.3 Source_evidenceePCR502WS150 Sequence/Annotation Release
Overlaps_Gene Y37H2C.3 Source_evidenceePCR502WS150 Sequence/Annotation Release
Chunk_score Abs_score439
Max_abs_score439Y37H2C.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1827043618271122
Overlaps_transcriptY37H2C.3 Source_evidenceePCR502WS150 Sequence/Annotation Release
WB_DNA_textTH:50-d8687ggactcacttttgccagctcgataggaatgctctcggagcccgcgaaaagtacaccccaggcttgctgagtctcggtgataaccagagtgtcaagtgtgaaaaatgggcttttgagaatactcgacagcgtcatgatggccaagctcaggttatttgatttttccattgctccgccattttccacgagacgcccgttttcataaagaccaactatagagtctgtacgattcagaaaggtgtagatcattgaatgagtgggggataacgttaggatggtgttgaagtatcccgcggaaagagtgatcgtcttgaagttccagtccagggagtcgatggcgttgcggaacacgctgcagacacggcggaaggggaatctagaattcgggcaagttttggcgtgtttttgaagcttggttcagaattttgttgccgaaaattcttgttcgtaggcctgctacaatttaaacgcgcaatttcagcaggatagatcatagggctcaaagtgcgctgctcaccgttcaatcggctcaatttccatcaaaatcttccgtacaatctcaaccggcatggtcgagagctgaagagcattcggatcaaacctgcagcatcaatattaagagagatattcaaaaaattaaccaacttctctccactgtccagctccaattccccctttccaagcttat