Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:50-f10   

Cenix:50-f10RNAiCenix:50-f10
PCR_productcenix:50-f10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC09H10.7 Source_evidenceePCR608WS150 Sequence/Annotation Release
Overlaps_Gene C09H10.7 Source_evidenceePCR608WS150 Sequence/Annotation Release
Chunk_score Abs_score566
Max_abs_score566C09H10.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII1110824211108897
Overlaps_transcriptC09H10.7 Source_evidenceePCR608WS150 Sequence/Annotation Release
WB_DNA_textTH:50-f10656tcaggatttcttcacccaggatacagtggtctgcgcgtttcgaaacaaggagaagaccacggattttgtcttcacatcgggtccaattattctcatttgtgatggaacgacgcgacggaagatgattaaacgacggttcaaaatggagtttgatatcaaaaaagtgttcttccactcgttcattgtgactcgaaacgctgaaaagttggcaactgagaattgtggtggacctgatacgaagcatcgggattatttggttgtgtgcggtgagcataagctccagttcatatcgcttcccgactatcatttctatcactatgaaattccttttaaggtgagaatttagtttgaaattctgataatttcaaatatttccagcttcgcaacgtgttctcctgctcgacaagtcttctggtcgaacggttctacgattcatccagcgaacaaaccttccaccatcacgacacatttcacctctactcgctatccggtccattcggcgagcttctcccggttatctacaagacaagcggctaccatccacaatggaaattctgttggcaatcgcatcgagacgaggctggactcgttgacgctcagcaaaattacgttgttgtctatgatcagaaggagaagacgcatcggatttatatggc