Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:50-g1   

Cenix:50-g1RNAiCenix:50-g1
PCR_productcenix:50-g1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C27H6.8 Source_evidenceePCR531WS150 Sequence/Annotation Release
Chunk_score Abs_score489
Max_abs_score489C27H6.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV99892319989813
Overlaps_transcript C27H6.8.2 Source_evidenceePCR531WS150 Sequence/Annotation Release
C27H6.8.1 Source_evidenceePCR531WS150 Sequence/Annotation Release
WB_DNA_textTH:50-g1583aatgtggacaaagactccgcctgggattccactttccttcgaaagatcgtcatcacggagaccacgccaagcagctggaagtggcatgcgattctcgaatgatgacattttgtcgactgggattgcttgaacgcgccacgaagcattggtagaatctagaaaacagataataattattgaattttaaaaaattaaataatttctaacccgagaacagaatgtaagtgatattatcgtcggcaatattcttctctacttcaatgtcgaaaaagtgttctttccacgggcatccaccgttctcgataagaatgatccttccagatgcatcaatttcaaatcgtttatccacagcagcttcgatgatctctctagctggccaccaaacatttgccaagtacttcactgatcgtgaaaactcttcaccgatgaattgcattgcttgttggaatcgttcatcagcatcattctcaggttcattccaatgggaattgaattgaccagtacgcgatgaaagatttcctgatgaatgatatcttggaactccgtcgtattgagaaatcccgttatcaatggcgtcgattga