Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:52-b2   

Cenix:52-b2RNAiCenix:52-b2
PCR_productcenix:52-b2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSR09E12.4 Source_evidenceePCR542WS150 Sequence/Annotation Release
Overlaps_Gene R09E12.4 Source_evidenceePCR542WS150 Sequence/Annotation Release
Chunk_score Abs_score479
Max_abs_score479R09E12.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV771770772399
Overlaps_transcriptR09E12.4 Source_evidenceePCR542WS150 Sequence/Annotation Release
WB_DNA_textTH:52-b2630tgggtcaacacggatactgaacagatattacaggggtgagtaaaatgaaatgcttgttgtactctgttgaacttctcaggaatgggtatttacgcgagaataagttaaacatatccgacgtaacatatattgggcccaactattggaaacttgatgaaaatagaaatgaagttataaattggagaacaatgttgggaatgtctattgcatcgacactgatctcgatttccttcgcaatgattgtcatttttgcaactttaagctacaaagaggtctccaagctaaccgagctgacttcccactccgaaaaattccgttcaattcaactgcaacttttaaattctttggtgttgcaatcacttgtcccggcgtttttcatacagttgccatcgttcgtcctatttctggcgcctttttttcattgtggaaggccagtgtttggcgagataattggtgtgacggttgctctatacccagtcttggactcacttccaacaattttagtgatcaaggctttccgtgaagcaatatttcgtgagtaaaagttgccagccaaataagttgagtgtattttccagattgttgcccattcactaataaaaatgctacacttcccacatccgtagcact