Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:52-h3   

Cenix:52-h3RNAiCenix:52-h3
PCR_productcenix:52-h3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST05G11.1 Source_evidenceePCR593WS150 Sequence/Annotation Release
Overlaps_Gene T05G11.1 Source_evidenceePCR593WS150 Sequence/Annotation Release
Chunk_score Abs_score551
Max_abs_score551T05G11.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1593004315930683
Overlaps_transcriptT05G11.1 Source_evidenceePCR593WS150 Sequence/Annotation Release
WB_DNA_textTH:52-h3641catgtgacctggacgacaacaaggtttgccagtttgtttcaagcatgttttgtgggaaatcaagtgtacttgattcaagaaagtccaattacaacagaggcagttgtagaccttcttgatgttatgttggctcttcatgtgatctcggaccgtctcgttctccggaatttggcgattgcacaagaggcacgtatgacccgtcatgtgaaatcgacgccgatgctctcgtaaagagccttcgtgaaagaaatcttttccacagaacccgcatggtattttttctaaaaacaaactggttgagctttcgttagattaaataaaaaaattacctctgggagtacccgaaactaatgttcttggagtcgaagtagacgctgaagagcggtcggcagattctataggttccatcttcaacgaggacgcttgaataatcgaattttcggcgatcattggtacgggcgatggggagctgtgaggaacatcatcggaaccattttgtggatcagtgttcaaggcagaagcttcacgagccggtgcagtcataggcatagccaacggtttcagcaaaccaggacgcccagtgcttttcatacattcttcatggcacttcaaataaatttccgttccgaagctccagttac