Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:54-f7   

Cenix:54-f7RNAiCenix:54-f7
PCR_productcenix:54-f7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene ZK616.4 (3)
Overlaps_transcript ZK616.4.1 Source_evidenceePCR512WS150 Sequence/Annotation Release
ZK616.4.2 Source_evidenceePCR512WS150 Sequence/Annotation Release
WB_DNA_textTH:54-f7662attgccgttcaagaagcacttcctgatgatactattgagaaacaagaggctatggaagaagtacgcagtttcaatttttaattcattttcaatgaaatcattatttttagggtgataactcgaaagtgcaaacaaaacgcgagaagaattttttcatcggaacgaccaaaatcattgtgccacgcgccagaactaacatggaaagttttatgaaagaaggattaagtgagtaatttgacagaagttaaagttaaagttaaaaacaaaaaaatgcttttcagtcgaagattgggagttgttcgaaaagattgtggaacattcgtatgagaatatcctctactccaatccatctgaacatccggttttgttttctgaaagctcggtaagaacattaaggattatttaataagaaacacttgttttcagtggaatgaccgtgctcgtcgggagaagctgactgagatcatgttcgaaaaattccaagtccctgcgtactacctctccaagaatgttgttctttcctgtttcgcacaaggaagaacgcacggattgatggttgattctggagcaactcaaacttcagttgttcctgttttcgatggctacgcagtgactcacgcggtggtaaaatgtccaatcggcggcgatctcatcacagaaca