Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:56-d5   

Cenix:56-d5RNAiCenix:56-d5
PCR_productcenix:56-d5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST08B1.6 Source_evidenceePCR519WS150 Sequence/Annotation Release
Overlaps_Gene T08B1.6 Source_evidenceePCR519WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRV19707381971258
Overlaps_transcriptT08B1.6 Source_evidenceePCR519WS150 Sequence/Annotation Release
WB_DNA_textTH:56-d5521agcgacatcatcgacaactgcaagctggaaatcattttctgcgaaaacgcaaagcgcgccgaagggttcctgtcgtcgaaactcggagatcgtcttcgttcgttgaagaccttaattattcttgacaagacgactacccttcagaagcatgatgacgtggaagtgatgagcttggatgaattcaaggagatcgggaaaaggaataagagaaatccagtgaaaccaaaacccgagacaacctatgtgatttgccataccagtggtactacaggacgtcctaaaggtgttgaaatgtcacatggaagcctcgtgacgtcagtctccggaatcttcacctcctggacaatagcctataaatggaagtttggactggaagacacttacttcagttttctatccttagctcacatctatgagcatttgattcaaacgttgactatatactttggagggaaaattggaatttatgatggtaacactgccacactcattccgcagattcagaagttggagccaacgat