Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:57-d7   

Cenix:57-d7RNAiCenix:57-d7
PCR_productcenix:57-d7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene T14F9.1 Source_evidenceePCR568WS150 Sequence/Annotation Release
Chunk_score Abs_score484
Max_abs_score484T14F9.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRX22381922238904
Overlaps_transcript (2)
WB_DNA_textTH:57-d7713gaaagaagagcgtgaccaggttcttgccgctaacaatgccaatggacaggcagctaagaccatggcaaacctcatcactcaagtcgccaaggatcagaatgtacgatatgtgcttactcttttcgacgacatgcttcaggtaagaatttacaaaggtcttgtgatcaataatagaaaaaatattcaggaagacaaatcccgcgtggaacttttccactctgcggctgctcgtcagaagcgcaccgtctggtcgcaatatcttggaatcttgcaacgacaagataatttcatagtcaaccaggtattttttgggtgttaaatgttttggcattaattatgtcgtaatccagatgagctccatcattgccaagcttgcctgctttggaacaactcgcatggagggacaagatcttcagtactacttctccttcctcaaggagcagcttaaaaactctacggtaagagtttaagtttgcaattttaattttatgaatttaaagtttcagaccaacgactacatgaacaccactgctcgttgccttcagatgatgctccgtcacgatgaatacagacatgaattcgttgattctgacggagttcagactcttgtcactgctctcaatggaaagaccaacttccagttgcaatatcaacttatctttgctgtttggtgcctcactttcaacgccgacattgccagaaaagctccatct