Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:58-c4   

Cenix:58-c4RNAiCenix:58-c4
PCR_productcenix:58-c4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSB0395.1 Source_evidenceePCR503WS150 Sequence/Annotation Release
Overlaps_Gene B0395.1 Source_evidenceePCR503WS150 Sequence/Annotation Release
Chunk_score Abs_score398
Max_abs_score398B0395.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRX1601960616020610
Overlaps_transcriptB0395.1 Source_evidenceePCR503WS150 Sequence/Annotation Release
WB_DNA_textTH:58-c41005ttccattccatggtccgtatcggacaagctcatttgatctatcaagactacaccatgtctatgatgaacttcttcctagtctccggcggtggcattcttgtcggcgtagtttttgcggtagtagctgctttaggtgtcaagtaagttgtgtcattgtgaaatttgtaaatactgattaatgttctacagatggagctcgaatgtgtcagttcttcagccaattatttgcatcacagttccgtatatggcatacttgtgctcagaaattgtgcatgtttcgggaattttggggtaggaaattgaacaggacagttgaaaatagataaataaaaattgtttttttttagaattgtggtatgcggactttgcatgaaatcttatgtaactggaagtatggaagaacgagctgatatcactgtaaaatataccctgaaaacgttatcatcatggtaagatttttcctatatacatattgagtttgttttataaataatatttaaattttgcaactaaatgttttttatgtccgaattatttctgaacctaaaaatatgtagctaagtaaatcctcggtttgaaatatttgttttccggttaaatcatgttttccattcaagacatttcgtggcagatgtttaaaaagccatataaaatggttttgcaaaattcaagctattttctcaaaaaataatccaagtcataaaatacaagtaatatggacaaaattaatagaggaagggataaaccttatagatgaaaaatctaatcacgttttacacagaattacccattttcagctgtgaagctattatcttcgtattcttgggattttccatattttcaaaggatcataaatgggactttggttttgcaattgtcactgttatcacttgctttgctgccagattcctcggtatgttatttaactatcaccatattgctaaaaatcagttcattcacagttgtgttcacattaacatgggtggcaaacaagtggagaatgca