Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:58-e12   

Cenix:58-e12RNAiCenix:58-e12
PCR_productcenix:58-e12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C18D4.2 Source_evidenceePCR502WS150 Sequence/Annotation Release
Chunk_score Abs_score481
Max_abs_score481C18D4.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1752876317529264
Overlaps_transcript C18D4.2.2 Source_evidenceePCR502WS150 Sequence/Annotation Release
C18D4.2.1 Source_evidenceePCR502WS150 Sequence/Annotation Release
WB_DNA_textTH:58-e12502ctgccttctccaaatcttcgaaacaaaacgttgttgagtggtatcagaagagattgtgcagtttcacgtatattttacgtcacagtctactcaaccaaaagaaaccaatcgaatcattttccataagtcttccctggttcattaatgagaggggtagtccagaattctattcggctggttatcattttatttcaatgtttggccatgaagtaccaatgtacaccaagtttcttgacctcaagattgaaagtcgtgcttgtgagcaatgccgaaaaacggatgaagttcgcaatttggcaagttgtgatgttcaccaaaagatgtttcaaaagcttttggaagaaaatcgagaaatatgcggacctaactccggacatccggattaccagaacagaccgattacttacacacaagacgagtacgaacagagaattgatctttttgtcaaatactttgaagacatcttgagctcagttggtcatacaattcctgtcgaagcgtt