Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:58-h11   

Cenix:58-h11RNAiCenix:58-h11
PCR_productcenix:58-h11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC17G10.2 Source_evidenceePCR519WS150 Sequence/Annotation Release
Overlaps_Gene C17G10.2 Source_evidenceePCR519WS150 Sequence/Annotation Release
Chunk_score Abs_score456
Max_abs_score456C17G10.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII55953745596000
Overlaps_transcriptC17G10.2 Source_evidenceePCR519WS150 Sequence/Annotation Release
WB_DNA_textTH:58-h11627gaggagccgaatgtcttctggaattggaatatgcaaaagacgcgctgaattggattgaaagcagcaaaaagattttcgcattcacgaaagaaacttctgacactcgtatgttcaattttgatttaaaaaaaagttaaattttcacaattttattttacagcggatcttactgatgatgagaaaaaattcatagatcaattggaaacacttcgagtaaaatcagttgaactgtcattgaaagaagaaagagataaaagaaaatcaagagccgaagaaagaaaagagacagaatcgaagaaacaactattagatgcactcaaggaacggaatttgaatttatgtccccgcgttccgtttgatcgtcccgaactcatggatatggcgagacttaccgtatcccttccgttgatgcattcagtaagtttaatttattctgaaactttgagtttctctaattttctacatttcagcatgaatgtgtcaaattcgatgatgatctaaatcttgtatggccgatccttctacaatatcccgaagctggtcaaactgatgttcttaccgagacaaatgaattaacaaccgtcggagaattgttaaaagaagtgttaaattcaccagctcagtggg