Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:62-c10   

Cenix:62-c10RNAiCenix:62-c10
PCR_productcenix:62-c10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST22B11.5 Source_evidenceePCR556WS150 Sequence/Annotation Release
Overlaps_Gene T22B11.5 Source_evidenceePCR556WS150 Sequence/Annotation Release
Chunk_score Abs_score535
Max_abs_score535T22B11.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV47009374701492
Overlaps_transcriptT22B11.5 Source_evidenceePCR556WS150 Sequence/Annotation Release
WB_DNA_textTH:62-c10556ttcgtttgcttgattcgttggtacatgagtggttgagtgaacatcggctcgtcgagctcattgtgtccgtgacgccggtaacaaacaagatccacgataacgtccttcttgaaagtcttcctccaatcggcggcgacattgcacacgtgcattacagcctccggatcgtcgacgttcacgtggaagatcgggcatccgacgacacgaccaacatctgtacaatatggagacgagcgagaagatcttggatcggtagtgaatccgatttgattgttcacaacgatgtggatggctccgtgagtcgtgtaactcggcagatcatccaaattgaacgtctcgagcacaacaccttgaccggcgaacgcagcatctccgtgaagaaggatagccatcgtccgatcgcacttctcatctccagcatagaaagcttcagctcggacctttcccatcacaactggatcgacagcttccaagtgagatggattagcgacgacggcgattttaacgttcttctgtgattgtctgttcaatcgttcgatgcagactcccaaatggt