Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:62-e3   

Cenix:62-e3RNAiCenix:62-e3
PCR_productcenix:62-e3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS T01C8.1a Source_evidenceePCR511WS150 Sequence/Annotation Release
T01C8.1b Source_evidenceePCR517WS150 Sequence/Annotation Release
Overlaps_Gene T01C8.1 Source_evidenceePCR517WS150 Sequence/Annotation Release
Chunk_score Abs_score454
Max_abs_score454T01C8.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRX1680113816801808
Overlaps_transcript T01C8.1a Source_evidenceePCR511WS150 Sequence/Annotation Release
T01C8.1c.1 Source_evidenceePCR511WS150 Sequence/Annotation Release
T01C8.1c.2 Source_evidenceePCR511WS150 Sequence/Annotation Release
T01C8.1b Source_evidenceePCR517WS150 Sequence/Annotation Release
WB_DNA_textTH:62-e3671tcagtgctcacgagtggttccagaaggatttgccgaactacttgttcccaccaatcaacgagagtgaggcttccattgttgatattgaggctgtccgagaggtcactgaggtattaatcgtgttcgataggagcagaagtttctaatcacaatgaaaagtttcagcgctatcatgtcgccgaagaggaagtcacctcagcattgctgggagatgatccacatcaccatttgtcgattgcatataacttgattgttgataacaagagaattgccgatgagactgccaagttgtcaattgaggagttttatcaagtgacgccgaataagggacctggaccagttcatcgccatccagagcgcattgcaggtaggagagggtgcatagaaaaactcttggtggcaaagaataataaaacttttgcatcgaacatgaaattcgtaaaacaatatctaaatcttcaatttcagcgtcagtcagcagcaagatcacaccaactctcgacaacacggaagccagtggcgcgaaccgcaacaaacgtgccaagtggcatctgggtatccgatcccaaagtcgtccggaagacatcatgttcgaggtgttccgtgcgatgaagcagctggacatggagtggaaggtgctcaacccatatcatgtgattgttcgtcgcaag