Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:63-e3   

Cenix:63-e3RNAiCenix:63-e3
PCR_productcenix:63-e3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY37E11B.4 Source_evidenceePCR506WS150 Sequence/Annotation Release
Overlaps_Gene Y37E11B.4 (3)
Overlaps_transcriptY37E11B.4 Source_evidenceePCR506WS150 Sequence/Annotation Release
WB_DNA_textTH:63-e3524gcattttccagctcttaccgtcggcgactctggatgcggctccagcttaaaccgtccaatagcccatccaatattacacgcactagtcggcacagtttgatgaaatttataccgaattttcccgttttccgagacttctcgcttctcctcaagctccccactggccactgggaccaaatggggctccaactcaaaagtgagctcccagagggccaactgatcgggctcatcaaggcaaacagtccattctcgggctcccgaaatgtgtggggtatggtaggtgaatacgtgacaatcgtgttcgttaaaatccacaaattgtagtccacgtggaggatcgcggactaccgtatccacacggagccgaaccgctttccgatgcttgatcttcttccgaacctctttcggaatgagaatctgaagctcgtagtcattttcggcgagcttttcgtagagcaccggctccagacttgaaatgctcttttcctgagccaaatccttccagaaatcccgcctggaatatt