Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:65-e6   

Cenix:65-e6RNAiCenix:65-e6
PCR_productcenix:65-e6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSR08H2.13 Source_evidenceePCR553WS150 Sequence/Annotation Release
Overlaps_Gene R08H2.13 Source_evidenceePCR553WS150 Sequence/Annotation Release
Chunk_score Abs_score532
Max_abs_score532R08H2.13
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1538830015389035
Overlaps_transcriptR08H2.13 Source_evidenceePCR553WS150 Sequence/Annotation Release
WB_DNA_textTH:65-e6736taaaaatttgatttcgcggcaacatttaaaaaatcgaatttaaaatttgaacaaaacgacaaagcagctgacacctcgcgggtatagtttcttgttttgaacccacgaagtgttggccggcctatagcagcagacatgtcacgggccacaccctatatttaacaagtttccagccatatacagttcctgttatggaatgatgattgtcctgctcaccattaacttctactaccgatacctttccgtcacatgtcctgctaaactcactagattctcggctaaaaactctccgatttgggtgttccttatactcttcaactcatccacgtggtttgtactgagctattttgtcaatggcccaacttcgatgaaagatgaaatcttacaacctgagctgttacaagcttattgtatgcagcctgaggattacgcgtatgtgggtcctcaatacttttataaagacgaaggagaaatgaaattccatctcccatcctggattgcttccggcggcatggcattcactatgttcatcacaaatactttgctgacatactttggcattgaaacctacagacatcttaacaaaattggcagcattgccggtattgagtaccgagagcttcagcggcaacttttccgaactttggttattcaaacagctatcccaatggtctttatgtacttcccaatttcctgtatgttcctgttcccgatattcgggataaaagctgaatcg