Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:68-b9   

Cenix:68-b9RNAiCenix:68-b9
PCR_productcenix:68-b9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC45H4.9 Source_evidenceePCR619WS150 Sequence/Annotation Release
Overlaps_Gene C45H4.9 Source_evidenceePCR619WS150 Sequence/Annotation Release
Chunk_score Abs_score536
Max_abs_score536C45H4.9
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV21534132154323
Overlaps_transcriptC45H4.9 Source_evidenceePCR619WS150 Sequence/Annotation Release
WB_DNA_textTH:68-b9911tcaattgcttgacatttcggctgaaatcacaacatttttcggaattttttttgcgattttttcgagtcttatgaacatttttaatttgaagaaaatagaaaagttggttttttttgaagttgtgatttcaattaatcttatattccaggaaaaagaaaaatgatatggttttattttactcacgttttattttcgatgcattttatggcatcacagttacaattttcctttctctaatgattgcggccaatttcaataatttggaaacaattaatcactttacattactctctggattgttggtctggaatgttggaatatcacaagccgtggtggcactcatgatatcaattgaaagaaacatggtatcacatgaagcagccgacatttcacggtgtaaaattgcaggcaattttcacccccatcttctaccgtaatcatcgttcacttgttactaattcagtgattctgtgtctaatatttggctatgctattttccaatactcatttatatattatttctgcaattttgaattaacttttccaagaaattgtctgacaattggttgttccataaacgcatgttccagtcggttttggacaaagtcgaaattggtctgcgctgagccatacttttccgttttcataaaaacttttcaggttatttttgtcctcactttctcgttcgctgctcttttatcatcgaagttgctctggaaggtgttcaaaaaagataacaaggattttaataaagtaagcgtttaattgtaagaattttaaaattaaactgggtaatgtttttaaatgactccttccaaatttgccccagattccgaatatctatgtgaaaaaaattcaaaaaaattttcctgatttgagcttgaaatcgtgattttcatttgcgtcggttc