Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:68-d3   

Cenix:68-d3RNAiCenix:68-d3
PCR_productcenix:68-d3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC14A4.14 Source_evidenceePCR902WS150 Sequence/Annotation Release
Overlaps_Gene C14A4.14 (3)
Overlaps_transcriptC14A4.14 Source_evidenceePCR902WS150 Sequence/Annotation Release
WB_DNA_textTH:68-d31092cctcgagtttcggcattaacccggctttcagccgaggttcgatctgcatcgcaatggatcaaagcaaggtatttgaattttaaattttgtaaaatatatatttaatatgattcattttcagtaactctaaaacaccagacgacatcaatgttgagaaactcttcgttgagaaggaagtgcaaaagctactgacggatttaacagaaattgatttggagcacaaagtgttcagaccgcgaagaacttcgattcaacaaagatctcatttcgctcttatgactgaagaacgacttgaaaaggtttgtttgaaaatgatttataatttaccgcatttgtcgatttacagtcgagtttctgataaacttggatctgctagactagaaactactcaccaaaatgagaagctatttattcaatttgacttatttttttccagactcgagagcgtatgcgtgaagaagctcgcagattcctacaatttgttccagtgaaagaacctcgcgaggagagtgttcagatcctcgccaaagatctcgaattgaaggattttgacactagcaaattcgtattcactgatatcactttcgatgcgaccgaccaggatcgtactgtagtcgtgagagaacccgatggtacattgagaactgcgaatccagaagaacatgatcgaatgaacagaacttattatcaaaaaccgaatcgttctgtgaatcctccaccactcttctcggatccaaatctacaaaatgctcttgataagaatgatcacgaattcgttctagactgggcttgctggttttacgagcctgacgatccggcctatgttcgtttgagtcaactcgtatttgatcgtatcaatgaatctggtaaattccatgtcgtaacctcaactcgtcactttggaccattcactttttatttggcactgaacgataacattcagaagcttttgaactattttggtggacttggaagattatccgactgtgcaaatcttgtgagacttcagaaggctgttcgtcccgattggagagttacaattgctcagggagattctgatgagaagattgtaaaggattttgcgaagcagaa