Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:71-c3   

Cenix:71-c3RNAiCenix:71-c3
PCR_productcenix:71-c3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC01G8.5b Source_evidenceePCR511WS150 Sequence/Annotation Release
Overlaps_Gene C01G8.5 Source_evidenceePCR511WS150 Sequence/Annotation Release
Chunk_score Abs_score469
Max_abs_score469C01G8.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI52857965286697
Overlaps_transcript C01G8.5a.1 Source_evidenceePCR511WS150 Sequence/Annotation Release
C01G8.5a.2 Source_evidenceePCR511WS150 Sequence/Annotation Release
C01G8.5b Source_evidenceePCR511WS150 Sequence/Annotation Release
WB_DNA_textTH:71-c3902tgcaacatcactgcgtacaattaaaaaatctcgcttttaaagatcggattttttattctttcacaattttttttagttttttctttttgtatctcttttattgttgcaaattttttttttaaattaagcttttttgttacagtaatcaactaatttcaggaattactgcatactttttttcattttaaaattttaaaacagtaatttcagactgaaaattactgctcgataattgttaatacggtatttaaaataatttttttaaagagaattttttgtttctattttagtttcaaaaataaaaaatacctgtgtctgaagttgtcttgtaacagtagtctgtctctcgacttcttctctcatcgaaaaaacttcacgttcacgagcatcaacttggtctctcaaatgacgtctctcaccatcactcattgctttttcggattgaagttgagcagtgagctcacgaagttcgtattccttctgttccaatgcttgtttagccaattgcaattgcttgagttgagcctccaatgagtgaattgtattgtgtgcttcagccaattcaagacgagctctctccatatcttcctgcatttgagccatacgcttttcggcgtcacgttgacgctgttcggcttcttcgcgagcagacatctcctgtacgatcaaaacagatttgagtgaaagtttttttagaaattatttgtaaaaacatgtttcaaaaatttccgcaacttactctggtgagcttctcctgctcggcaatcttaagagcacgatcctctctggcttgttgcttcatttgttgaacttcaatggtatctggctttcttctacgcatgtaaagctcgtgatttcccatacacaaagcaagaatacgtttgttgatacggagtcgtgga