Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:72-c2   

Cenix:72-c2RNAiCenix:72-c2
PCR_productcenix:72-c2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS H28O16.1a Source_evidenceePCR571WS150 Sequence/Annotation Release
H28O16.1b Source_evidenceePCR267WS150 Sequence/Annotation Release
H28O16.1c Source_evidenceePCR466WS150 Sequence/Annotation Release
Overlaps_Gene H28O16.1 (3)
Overlaps_transcript (7)
WB_DNA_textTH:72-c2631tttcaggttctctccatcggagacggtatcgctcgcgtttacggattgaagaacatccaggccgaagaaatggttgagttcgactcaggaatcaagggaatggccatgaacttggacgttgacaacgtcggagttgtcgtcttcggaaacgataaggtcatcagagaaggagacatcgtcaagcgtaccggagccatcgtcgacgttccagtcggagatggtcttctcggacgtgttgttgacgccctcggaaacccaattgacggaaagggaccaattgccaacgccagaagatctcgtgtcgaagtcaaggccccaggaatcatcccacgtttgtctgtgcgcgaaccaatggttactggagtcaaggccgtcgattctcttgtgccaattggacgtggacaacgtgaattgatcattggagatcgtcaaaccgggtaagtattgattttctcgaatcttaattaaaattattaaacaattaatttcagaaagaccgccattgccattgacaccatcatcaaccagaagagattcaacgacgctggagacgacaagaagaagcttttctgcatctacgtcgctgtcggacagaagagatccaccgtcgcccagattgtgaagcgtctca