Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:73-a2   

Cenix:73-a2RNAiCenix:73-a2
PCR_productcenix:73-a2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY71F9AL.16 Source_evidenceePCR503WS150 Sequence/Annotation Release
Overlaps_Gene Y71F9AL.16 Source_evidenceePCR503WS150 Sequence/Annotation Release
Chunk_score Abs_score482
Max_abs_score482Y71F9AL.16
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI28857532886255
Overlaps_transcriptY71F9AL.16 Source_evidenceePCR503WS150 Sequence/Annotation Release
WB_DNA_textTH:73-a2503gccagcatagatcctccaaaccaaaccgcatatctctgcattttatgcgaaatcacttgaacatcaatcggcttcggcttcaaccgtccaccactcagcgtctcgctcatctgaagtctcccatcactgagacgcttcacgtcacgctgaagcttccgtgcaaagtccttgaacattgtagatcctccagagagcacaatattctcgtagagtccacgacgaacatcaattggacactgttgaataagtgtgtcaattgtatcagagattggtgtcgtgaattctggattacagaattctggatggaaaaagatttcaggacccaagaatctctcgtatccaacgtcgacgttaaacggtttttttgtaatcgaattaattccatcgtaggttcgaagccactttgccgcgtccgtatcatactttacaaattccttcataacatccgggcacacgtagcagaacttttccttaatcatcttcgccacctcatagctctgctc