Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:73-f1   

Cenix:73-f1RNAiCenix:73-f1
PCR_productcenix:73-f1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY57G7A.6 Source_evidenceePCR607WS150 Sequence/Annotation Release
Overlaps_Gene Y57G7A.6 Source_evidenceePCR607WS150 Sequence/Annotation Release
Chunk_score Abs_score586
Max_abs_score586Y57G7A.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII12831861283792
Overlaps_transcriptY57G7A.6 Source_evidenceePCR607WS150 Sequence/Annotation Release
WB_DNA_textTH:73-f1607cttcagccatttttcgaagcggtccaagaagcggcaacgactttgacacagcagatgacacatcattgaagttgtttgcaaaagctttatccgacgtcaattttcttagaatcttggctgatcttgcagttgaagcaattttatccatgtctgtggtgttatctttgaaacaatcaagatgatctatcaaagtttgaatgcttgcttttcggaaattcatcaatccttgagctccgtcggcatgctcctggagacttccagagtcctggatcaacttaaacttctgagttaaaggaagcaacaatctgcccattattttaatgtcggatgaattagtagaattagagtatttttggaaatccttgctgttgacaacacttgaaattgactccaatgcttttacttgtttcaagagcaatagtgcatgaacagctccattttttaagtttgttgccaattgtgcattaaaagattctgatggacacgtcttcaaggtggttaaacttgtttcaatgccattttgaggcaataagtttccaagatgttgttgaagttcagtgacttgtctcatcgtgtaaaaatgactttctgtggtgactggtttcca