Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:73-g11   

Cenix:73-g11RNAiCenix:73-g11
PCR_productcenix:73-g11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC47D12.6a Source_evidenceePCR525WS150 Sequence/Annotation Release
Overlaps_Gene C47D12.6 Source_evidenceePCR525WS150 Sequence/Annotation Release
Chunk_score Abs_score462
Max_abs_score462C47D12.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII1169156311692183
Overlaps_transcript (6)
WB_DNA_textTH:73-g11621tggtgcgcacatttactgttccgttctctttttctttggctccaatgacgagaatgaagttgaactgggcaagctgggcctttcggacctaaaattttaatattgaaatatcttaagaatggagttaaatgtacctgcttattcatcgtgtcaccacaattctcctcatactcaatctcaaatccggcctcgaagatctgctttttgacgtcatttgcatagtctctgactgactcgtgaacagtgatgattttacattgccttggtgagagccagaatggccattttcctccataactttcagtgagaatagctgtcatccgctcaactgatccaagaacagcacgatgaatcatgactggtctctgcttttctcccttctcgctgaaaaattgaaaattaaatttttttagattttagagtttttttctcactcgaaataggaaagatcaaattgattcggaagttggaagtcaagctgaattgtggcgcactggaagtttctcttgagagcatcttgaatggtgatatcgattttcggtccgtagaatgctccatctcccgggttcaacacccattttctgcctgaagcgttgagcgcattggtgagatctgcttcgg