Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:73-h5   

Cenix:73-h5RNAiCenix:73-h5
PCR_productcenix:73-h5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC06B3.3 Source_evidenceePCR520WS150 Sequence/Annotation Release
Overlaps_Gene C06B3.3 Source_evidenceePCR520WS150 Sequence/Annotation Release
Chunk_score Abs_score436
Max_abs_score436C06B3.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1389990013900570
Overlaps_transcriptC06B3.3 Source_evidenceePCR520WS150 Sequence/Annotation Release
WB_DNA_textTH:73-h5671tcttggccggttatccatagatcagttatcaacattttcaaattgttctcactgaaataatttgatattctcaattcactcaacgcatcacttactcataaacatcacttttcggattttgtttcatcttcaataaaaaggcatcaacgatatcctcaacgttatttggatcaatttcatagtcaccattcatgaaatctcttgatctttttatagcatccactgacacataatcaattatctcaaactgatcttttataatggaattaaaatctttagcgagaaacttttgaagagcccaaactggaagagtgaaaaatagtggtgtcatcttatccattccttcatcaaacatgtgtttcattgtgagaaatcgggattttgttctctgaaacgttaagaatatgcttcgttctctaattgctatatgcttacttcatcaaatcgaaatcctaagagcatattgttaatgatacttccaacagttaaatcaaagaattcattcacttgtaaaacagtggtcccatcaatagatttttcattgatttcagcacatctgaaaattatggtgattggtttatggtgaactctctttctaattttcggttaatggtaccttgcatcaagttcacttagaatcttctcctccatcaaatctcttcccattccca