Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:75-f6   

Cenix:75-f6RNAiCenix:75-f6
PCR_productcenix:75-f6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK08F9.4 Source_evidenceePCR523WS150 Sequence/Annotation Release
Overlaps_Gene K08F9.4 Source_evidenceePCR523WS150 Sequence/Annotation Release
Chunk_score Abs_score481
Max_abs_score481K08F9.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1514736915147941
Overlaps_transcriptK08F9.4 Source_evidenceePCR523WS150 Sequence/Annotation Release
WB_DNA_textTH:75-f6573tgacgtggcctacactatgcttcggattgaataatcgttacgcaaaattgattaaggagcgaatttccttcatttgccatccatattatcgagaaatcaaggatcaagatttggaagaaattgatatacgctatgacaataacgaaacaatgctggaaatctcagaagctcttaaaattccgccacgatatcttgagagaataaagtccaaggagagaaaaaccgtagcggttgctggatccatcgagggagcacataaacttcaaattttgaaatttctctatgaatccatcgtggagaatccgaaaagaaacacgttttgtacaaataatttcaattggaaaatatttagaaagaagtgagttttttaataaaatatttaaataatatttcgaataataatttcagatgccgagaaaactcaatcactcctccgaatttcttgacaactgcgcgatactacggaaatctgttttttcaagccgatagaagaattttcaattttttggagcctcagccaacgcttcacaagaaagttctgtattttcatgaagctctcgcaagatacttggc