Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:75-g12   

Cenix:75-g12RNAiCenix:75-g12
PCR_productcenix:75-g12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST09F5.11 Source_evidenceePCR527WS150 Sequence/Annotation Release
Overlaps_Gene T09F5.11 Source_evidenceePCR527WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRV1518552515186184
Overlaps_transcriptT09F5.11 Source_evidenceePCR527WS150 Sequence/Annotation Release
WB_DNA_textTH:75-g12660aaattggagtggcttcccttgaaaatattttgtgaaaattctgaaatttctcaaaataatctgaaaataaatttgttcaattcagtagaaccgatttcacttgttagtaacagagccaacttacaatttccagaataatcgccagaaaagtgtctcgaaaattccgtgcaataattgaggcaacctgtcgcttcaaggaaatcaaaattgaaattgcaagtttctataacccaactgtctcttttcatctggatgatgcgtgtatcacctacgaaacagtgggccaaagttgcattgtaagctttggaaagaaaaggaagaaggttaagaaacgaaattgtgtggatgttatgctggatgatctctcatcactattaagaaatccgaaactgaatctggaagtgttcaaacttcaattttacattttcgtagaagcaaaccaccgagagactcttgtaaactcccttccagtagttctaaagtctgcagagcctctgaatgtcagtgagtttcaagttaaaagagcacgattcgacgagatggtgcctattttggcatgcttcgaggcgggaaaacttaggaaattgagttttctgcaaagcattgaccaatatgacttgttcgaaactattgttcatttggatcaatggaaagaggcaa