Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:76-a12   

Cenix:76-a12RNAiCenix:76-a12
PCR_productcenix:76-a12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene Y53G8AL.2 Source_evidenceePCR502WS150 Sequence/Annotation Release
Chunk_score Abs_score420
Max_abs_score420Y53G8AL.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII32469173248285
Overlaps_transcript Y53G8AL.2.1 Source_evidenceePCR502WS150 Sequence/Annotation Release
Y53G8AL.2.2 Source_evidenceePCR502WS150 Sequence/Annotation Release
WB_DNA_textTH:76-a121369accgtagatcacagatgggcgaataattgttgcttctgggaattcttcacgtacagcaacttctccgagtccttttgaatgaagaaattgcgattttgcgacaaaatgtcccttttgtggttgtgtagttgctccgagagccgacaaatgcacaaatttctccacacccatttctttgcaaattcgagccaaacggcgggctcccgtgtcgttgacgtcatagtaattgtactttctgcaaggaaaaatggcttaaaattgggatttttagaaggaaaaagtggggaaatttgaatttttcaatagaaaatggcagttttctcgaaaattttggagaaaaattgagcaatttagttttttttgaattttttaaaaatattttttgaattttcagtgaaaaaaacggcgcgaaactcaaaattttgaagatttttcggacatttttcaaatttttagccaaaaagtggagccaaattcaaaatttaaggggatttttcaatttttaattgattttcagttggaaaaagtgaggaattttgagtttttcaatgaaaaaactggaaaaaaagagctttttttttgaattttgaatgataatttggtgtaaaaaaatttattttttgaattttcagtaggaaaaaagggttaaattccacattttgaaggtttttcaggcattttttcgaattttcagcgaaaaagagtgatttatttggtcaaaaacggcgcgaaatttgaattttttgaatttccggcatattttgtgaatttttccgctcaaaaatctgcaatttcctcacccagtcggcacacgagttccgatcaagttgatgacgacgttcgagtactttacagcctgaaaaattgattttttctggattttctagagaaaaatccaatttttctcgattttcacctagaaaactctttttttttcggaattttctagagaaaaaacctaatttttctcgattttcactgagaaaactctattttttctgaattttctaaagaaaaacccattttttctcgattttcactgagaaaactctattttttctggattttctagagaaaaatccaatttttctcgattttcacctagaaaactcgatttttctctcaatttccacgaattttaatacctttcgaatgctctcctcatccatcagctcaaatggaaaatagaggacttgtccgagctcgccgagcactttgtgctctctcatgtaatacggatcctggcgatacggaataatgatttgtgagccatttttcgcgaatttattgacaactggaagtcccaagaagcctgacgcaccgaatacggtcaccacattgccggagaaggaggctctgcaaaaatttg