Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:76-e9   

Cenix:76-e9RNAiCenix:76-e9
PCR_productcenix:76-e9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene Y45F10D.12 Source_evidenceePCR565WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRIV1377796413778763
Overlaps_transcript Y45F10D.12.2 Source_evidenceePCR519WS150 Sequence/Annotation Release
Y45F10D.12.1 Source_evidenceePCR565WS150 Sequence/Annotation Release
WB_DNA_textTH:76-e9800gcaccaaagagtgagaacccttacctccgtcttctgtccaaggtaacacttagtttttgttgctctgtttaaaaattaattttaagctctacgctttcctcgctagacgcactggagagaagttcaacgccatcgtcttgaagagactccgcatgtcccgtcgtaaccgtcagccactctcgctcgccaagcttgcccgcgccgtccagaaggctggaaacgagaacaagactgttgtcaccctctcgactgtcaccgatgatgcccgtctctacactgtcccaaagatctccgtaagcatttcttttaccgttaaaattgtaaaaattattcttggtttttatgaaaccagtttagtactgaaataatacgaaaacatcggagtaactccggaattcttcaaaattcgtctcattttcaattaatttaatttaggtcgccgctcttcacgtcaccgaaggagcccgcgccagaatccttgctgccggaggagaaatcatcaccctcgaccagctcgccctcaagtcgccaaagggagaaaacaccgtcttcctccaggtatttcacaatttttctattatctttatttatttttgtacattttcagggaccacgatctgctcgtgaagccgagaagcacttcggaccagctccaggagtcccacactcccacaccaagccatacgtcagatcaaagggacgcaagttcgagcgcgcccgcggacgcagagcttccagagcctacaagaactaagttgttgttattttgttcccatgattgttttcgaatcatgccgaat