Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:77-d3   

Cenix:77-d3RNAiCenix:77-d3
PCR_productcenix:77-d3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene Y65B4BR.5 Source_evidenceePCR625WS150 Sequence/Annotation Release
Chunk_score Abs_score583
Max_abs_score583Y65B4BR.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI535905536572
Overlaps_transcript (5)
WB_DNA_textTH:77-d3668caagttgacgtttcggatgattccgacaacgaggccgtcgagcaagagctcaccgaggagcaaagacgtgtggccgaggctgctggacttggagatcacatcgacaagcaggccaagcaaagccgctccgagaagaaggcccgcaagctcttctccaagctcggactcaagcaagtgactggtgtctcccgtgtctgcattcgcaagtcgaagaacatcctcttcgtcataaacaagccagacgtgttcaagagcccaggatctgacacctacatcatcttcggagaagccaagatcgaggatctcacccaacacgcccagatgtctgctattgagaacttgaagccaactcgtgaggccccacaactcaagactgtcgaagaggacgagaatgaggatgttgaggtaattcagtaacttaatcggatttattacattaattgtacggtttaaggaggattccaccggcattgaggagaaggacatcgagcttgtcatttcccaagccaacaccacccgcaacaaggccatcagggcgcttaaggaagctgacaatgacatcgtcaatgccatcatgagccttaccatgtagcttgtttcctgatgaccttgcagatactcttgttatcgttgtatctcttgcttatcccgttttccgttccaagtaa