Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:79-c7   

Cenix:79-c7RNAiCenix:79-c7
PCR_productcenix:79-c7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK08G2.8 Source_evidenceePCR544WS150 Sequence/Annotation Release
Overlaps_Gene K08G2.8 Source_evidenceePCR544WS150 Sequence/Annotation Release
Chunk_score Abs_score502
Max_abs_score502K08G2.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1586925015869844
Overlaps_transcriptK08G2.8 Source_evidenceePCR544WS150 Sequence/Annotation Release
WB_DNA_textTH:79-c7595gcgatacttccgataccccttccttgttgcaaattatataattgtcatcacttactgcttcatcatatacttagaaattcctgatcaagagattgcaattaaaaaactattcaaaaagtatcctcgattttataactttgaaattcctgtgtcatcatttatcgttattagtgatgaggacagatcctggcaaaagttacgacgaatatcagttataagctttattctgttggagataatagtttttggaatattgttacgagtaaaattgaagctatcaatgaagaaaattgcatcttctatatccagcaagacacttcaaatgcaaaaaagatttatcaaagcattgaatctccaggttaattagttgatgaaaaactttttttttcgaaatgtcatgacattccagattgctattccactgattgttatattcgttcccataatagctggtatgatatttaaagcattgtcaattgtgaaccctcaagccttcagtaacttactcaatttttacttttctcttcatggagtattatcgacaattctcatgctctatctacagaacccctatcgtgaagcggttttgtccatt