Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:80-f6   

Cenix:80-f6RNAiCenix:80-f6
PCR_productcenix:80-f6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS W07E11.3a Source_evidenceePCR321WS150 Sequence/Annotation Release
W07E11.3b Source_evidenceePCR228WS150 Sequence/Annotation Release
Overlaps_Gene W07E11.3 Source_evidenceePCR392WS150 Sequence/Annotation Release
Chunk_score Abs_score350
Max_abs_score350W07E11.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRX1009450610095103
Overlaps_transcript W07E11.3a Source_evidenceePCR392WS150 Sequence/Annotation Release
W07E11.3b Source_evidenceePCR299WS150 Sequence/Annotation Release
WB_DNA_textTH:80-f6598atgttggctgagtagtggggttcaccgtgcattgaatcattgataggatggagttattggaagtcgtaatctggcagcggattgaatcgttttccgaaactgaaaataataaaataaattctatcgatctgcaagtgtattaaacatttttgtaagaagtgattctagtaagaatacatgacgtttccaaatatgtgtttgggttttaagcttgatttatgttgtttttccaaattttgaaaaaaattcggaaacttttaaactacttgatatacttcatatcatcaattatctctcatactcaccgaatgggctcgcgcggggagcgtttgccaaaacgaatgggttctccacgaagacgttttgccattgctgaagcttcgaaaattccaagagtgttgtcgttgacagctggctgggcgacagtagtaccctttaaataagctagttggccacgtaataactgatcccgactagtgggaatggggagtatccgctttggttgcacaaactggaagggacttacaatgacggcgagaaggacgaggaaaagagcagataggattccagaaacttgcatggtttgcgacaattggtt