Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:88-g1   

Cenix:88-g1RNAiCenix:88-g1
PCR_productcenix:88-g1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSR09B3.4 Source_evidenceePCR543WS150 Sequence/Annotation Release
Overlaps_Gene R09B3.4 Source_evidenceePCR565WS150 Sequence/Annotation Release
Chunk_score Abs_score523
Max_abs_score523R09B3.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1191126511911925
Overlaps_transcriptR09B3.4 Source_evidenceePCR565WS150 Sequence/Annotation Release
WB_DNA_textTH:88-g1661ccgcctatatcgctgaaaattatcgtatttcttaatttttcgctttcagaatgttcaatcttcaaaaacgaatcaacggcaacaacgaggacggtcggtatcttgaaacccgcatcgccgtccgtgacaagctcctagctcagggtatgtggctgctttataaaaaattttgattttacaacattttcagaactccaacagctggagactgctcttcgcgatcagaagcaaaagctgtggcatctcgaggtcccatcaacatcgtgtcttcatgagttggaactcaccgtgacacctcaagaaggaatctatcgtggaggcaaattccgattcaagatcaccgtcccgccagagtacaacaacgtgccgcccgttgttaagtgcctgacaaaggtttggcatccaaatatcaacgaggacggatcgatttgtctatcgattttgcgtcaaaactcgttggatcaatacggatggcgtccaacgcgtaacctcaccgacgtcgtccacggactcgtctcactgttcaacgatcttatggacttcaacgacgcgctgaacattcaagccgcccagatgtggagtcagaatcgcgaatcgttcaatcatcgtgttcgggaatacatttctagatattgctaaggaccaacggatcggattacaa