Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:94-b9   

Cenix:94-b9RNAiCenix:94-b9
PCR_productcenix:94-b9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF21D9.8 Source_evidenceePCR567WS150 Sequence/Annotation Release
Overlaps_Gene F21D9.8 Source_evidenceePCR567WS150 Sequence/Annotation Release
Chunk_score Abs_score504
Max_abs_score504F21D9.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1928156219283244
Overlaps_transcriptF21D9.8 Source_evidenceePCR567WS150 Sequence/Annotation Release
WB_DNA_textTH:94-b91683ctcgacttgggtttgaggagaggtgtctcgactctggtatcacaatacttcttgcatccgtcgtatcatcaaaaaagaaagttttaagataataagcgagataatgaactcgagcaatcaagacatgaagatggtaggtggtataacaagaatgaaattctttaacggcaaaatataacaacggtgctgctgggcagcgtaaaacaatagtgaagaggaacgttggtgttcctaacgacggaagtaagtcgttccggcgtgttgttgtgagaatgagcctctccaatttctcgaacggtcagttgctttgcgtgagttctacaatagttattgtttaaaccgtgttatattagtgtaatatgcgtcaccttacaagctcgtctgttgcgagtggtcttgactgaagtgcagagagcttcatggtggtatttgcagccaacacgattggtgttgttggcgcacacggagcaagtgtccttggcttttgggcagccttcgtgatgccagtcgtcatcagtgacaccgacggtgagacagtgcttgcacatcgatagcgcttctgctcgttcgcgtcgagtgatccagttattgtagctggtacagttgctgatgtcgtggttagcggcacatagctgacagatctgcagtgtatgcaatttatgagtgttttatgatcgtgtcttacgttactgctcgattgagcgcctgcctgggcagcctggtgggatgtttcttggctctcagtggtgttgttgatagtcatggactgctggacgtcggcccattggtttgtcaagccggtgacggcgttgtagacattgtccagaatttttgtgacgtcagtcttgagccctccgatgatcggagccatcacttcctcgatcgcgtaggcgagagctgtaacaacaactggttgtacttttaaccactgagagtagtcatacctttttcctggctcttttctagctcgttgctcgcgcgggcagccggctcatacagcatttcgagtggatcttggatcacttcctcgtcaatcacagcgtctgggacgtgttcctcgtggacagccacaatctaggtgttgtcctcctcatgatctttgatggacgcggtcaatggaatatctgtgatgttatcgatcggattctccattgtctggaaattaaatcaattattcgcgtgataagcgctccgagatatcagaaattcataaggaaattgacggtcagtgtgcgtgtaacacaaaataataaagaggaaaaaagagaggtttaatatctggaaatgtttcgacagatatgtgactggaggtcagctgtgatatgacacgtaatactcattgttagatcttttgctattgaattagttctcgacctgtattttagggagtccacttcgcacgacaggcgttataagctgctggagcttgatgtgaattgatttgaaataataatgattattattattaaaattttgctgattattatgatgaatcagcgaggaccgaggagagttttccgttcggttattatacgaaaaatttcgaaacgtttcgaaaaatttcgaaaaatttcgaaaagaattttaggattcgattccaatttgtggaagtccgtgattgcgcgtcaaatgggatgctatgtccgcattgagccgttgtgtaccgtagccagcaagaaagtc