Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: SP12G12   

SP12G12RNAiKK:SP_12G12
Sequence BE228119
SP12G12
Sequence_typecDNA_sequence
Reagent_typecDNA_reagent
Overlaps_GeneK08E3.5 Chunk_score Abs_score605
Max_abs_score605K08E3.5
Specificity_index1
Rel_score1
WB_DNA_textBE228119307aaccgccgctggtgcagccatcaagtcattctctgggagctgttggagtcaatgtgccacgttcccgtttcttgccagtcaanaanacttctgatcttctgcttttaatgtcaaatctttacgatattgacaatggatccttgacgctgtctcatcaaanatccttcccaacaacaccgctggtgaagctcggatcttcattcgataaggtcaaggactacctgggacggttcaatggaatccctgatcttctcgagctggatcacttgacagtttctggngatgtctggttcggaaaggatgtntc