Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: SP20G1   

SP20G1RNAiKK:SP_20G1
Sequence BE228137
SP20G1
Sequence_typecDNA_sequence
Reagent_typecDNA_reagent
Overlaps_GeneC41C4.8 Chunk_score Abs_score724
Max_abs_score724C41C4.8
Specificity_index1
Rel_score1
WB_DNA_textBE228137522gttgaggaagtgtaggagatgctggaggtgctgccgatcgtgttatcaaccaggttctcactgaaatggatggtatgaatgccaagaaaaacgtgttcattattggagctaccaatcgtcctgatatcattgatccagctgttcttcgtccaggacgtctcgatcagttgatctacattcctcttcctgacgaagcatctanacttcaaattttcaaggcctcactccgcaaaacgcccctttccgccgatctcgatttgaacttccttgccaagaacaccgtcggtttttcgggagccgacttaaccgaaatttgccaaagagcatgcaagcttgccattcgtgaatcaattgaacgggaaattcgtcaggaaaaggagcgtcaggacagaagtgctcgtggagaanaacttatggaggatgaactggctgacccagttccagaaataactagagcacacttcgaggnggcaatgaagttcgctagacgttcccngactgntaaccatntcagaaaatacc