Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: SP3H11   

SP3H11RNAiKK:SP_3H11
Sequence BE228086
SP3H11
Sequence_typecDNA_sequence
Reagent_typecDNA_reagent
Overlaps_GeneT06E6.2 Chunk_score Abs_score1165
Max_abs_score1165T06E6.2
Specificity_index1
Rel_score1
WB_DNA_textBE228086439agttggatgtcgataacgagtagacgagacgtcgagaaccttccccgcaaaagtccagatatgttgatccgtgtcctcattacgattacgacctcggggaggccggaaacccggacagtatctcggactatgctcaagggatttttgactactacagacaccgagaagttcactttcgagtganaaagtaccttcacaaacatccggaggttgacgtcaagactcgtgctatcctcattgactggatggttganattcaggagacatttgagctcaaccacgagaccctttacaacgccgttaagctcacggatatgtacttgtgcaagacgaagaatgttgacaaaaacaccattcagaagcttgcatgtgtcgccatcttcattgccgccaagtacgatgagcgatctccaccactcgtcgatgatctcatctacct