Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: SP7H7   

SP7H7RNAiKK:SP_7H7
Sequence BE228097
SP7H7
Sequence_typecDNA_sequence
Reagent_typecDNA_reagent
Overlaps_GeneT01G9.5 Chunk_score Abs_score348
Max_abs_score348T01G9.5
Specificity_index1
Rel_score1
WB_DNA_textBE228097664gtacaaatggacgggtcacagaataaattcgattcgcgacgtgtattcgtgctggccgccacaaatattccatgggagctcgatgaggcactccgaagacgtttcgaaaagcgaatcttcattccactgccagatatagatgcaagaaagaagcttatcgaaaaatcaatggaaggaactccgaaatccgatgaaattaactatgatgacttggcggcaaggactgaaggattctcaggagctgatgttgtgtctntatgcanaactgctgctatcaatgngttganaanatatttcanatacgacaccaaatcattgcgaggcggggaactgacagctgcaatggaatcactgaaagccgaactcgtgaggaacattgactttgaagcagctnttcaagcagtttcaccaagtgctggtccanatacaatgctcaaatgcaaagaatggtgtgactcttttggtgccatgtaaatcaactatttattgngatctccttttagttnaaaatattgnggcctacctttggtttttgaaactctgaaacattgtacagataaaattttcaaggccaccttcatccaaacatctctccccgattcactctttcctgtaaaatacttattggttaaatttggatgtaaaatgaatcattttgccactg