Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: SP8B11   

SP8B11RNAiKK:SP_8B11
Sequence BE228046
SP8B11
Sequence_typecDNA_sequence
Reagent_typecDNA_reagent
Overlaps_GeneF13B10.2 Chunk_score Abs_score721
Max_abs_score721F13B10.2
Specificity_index1
Rel_score1
WB_DNA_textBE228046694ggncgttcacttgtccgaggaagctcgtcgtcgcttctacagcaactgggctaaatccaagaagaaggctttcaccaagtacgccaagaagtggcaagatgaggatggaaagaagctcatcgaggctgatttcgccaagctgaanaagtactgctcttctatccgtgtgatcgctcacactcagatgaagatccttcgccgtcgccaaaagaaggctcacctcgtcgaaatccaggtcaacggaggaaccatcgagcanaaggtcgactgggctcgcgagcatctcgagaaacaagtccaggttgataccatcttcgctcaggatgagatgattgacnccatcggagttaccanaggtcacggattcaagggagtcaccagcagatggcacaccaagaagcttcctcgcaagacgcacaagggtctccgcaaggtcgcctgtattggagcttggcatccatctcgtgtcgccttcactgtcgctcgtgctggacaaaagggattccatcaccgtaccatcatcaacaacaagatctaccgtattggaaagtctgctctcactgaggaaggaaagaacaacggatccaccgagttcgatcttacccagaagaccatcaccccaatgggaggattcccaagatacggtatcgtcaaccaggactacatcatgcttcgnggagcccgttctcggacc