Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:144-f1   

TH:144-f1RNAiTH:144-f1
PCR_productTH:144-f1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene Y39G10AR.13 Source_evidenceePCR1093WS150 Sequence/Annotation Release
Chunk_score Abs_score1030
Max_abs_score1030Y39G10AR.13
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI23047002305897
Overlaps_transcript Y39G10AR.13.2 Source_evidenceePCR1076WS150 Sequence/Annotation Release
Y39G10AR.13.1 Source_evidenceePCR1093WS150 Sequence/Annotation Release
WB_DNA_textTH:144-f11198gctgcttcggtacaacatcattccgaaatgtcttgaagaattgtgcgagacgacgtgtttaacgttgatggactctttttccacactgctgacgatccgcgcttcttgactttgacagcatcactaaagatttcctttagatttggctgaaaatttttaaatttttactgaaggagctgcaagaaaaaaaaaacaattacctttccaatcgatccgaagaattgagccacgtcgaatggtggattaatggcatgtcttctgacattctcacggacaactgcgaattcggcccaagccgggacatctttgcgtggatcatcttcttgatctgtctcgtcatcactgttaagatcgttcaaaccatagtcattctttgagttgttttgataggtacgtggcggagtcatttcgtaggctgcaggtggtggcgtttttcgaagagcttcctgacgagcttgtttctccgcgcatcttgcgagtgttgcctggagctctgcctcttctcgctctctttgcttctccagctgagcttgctcttctctctgaacggccagaaaatgctcctgctcttctcgagctctgagttgacgctccttctccgctttctctttcatttccttctgctcccgctttcgtcgttcatcttctgctaactgtagcagatactgctcctgttccagctgaatacgttgctgttcctgaagagcggcaagtgcggcagcagcttcaacatttgatgtagaagacgaagctgcgtgggccgatcgtttcgtcgctttcgcctttggtttatgttgacgcgccggtggagttgaatcatcacagctcatcggctccattttgacttgccggctaccgtttcgttgcaattctcgggaaggctgaaatgagttaaattattattaggaaaatacaatcaagtaaatactcaccgatagttcaacggtcggctgagccacaggagcagtcttctgtccatctgagccaattagaatctcaacttttcccttcttagcagggcctcgaccaggagtggatgtgctttccgccgttgggaagatttttctacttgcagccttgtttggagcatggtcttgcatcaaacgagctcttgttggcgactttgcactgttgtgaagtttcgccaaattagcattacgctcttccttttgcttcaactggtcgagcttttcctgac