Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: TH:215-e11_T7   

TH:215-e11_T7SequenceTACGATGACGTTGTCCCAAA
Length20
In_sequenceY75B12B
PCR_productTH:215-e11